Sangeri sekveneerimine ja genotüpiseerimine | Tartu Ülikooli genoomika instituut

TÜ üksuste kontaktandmed

humanitaarteaduste ja kunstide valdkond
Faculty phone: 
737 5341
Faculty address: 
Jakobi 2, ruumid 116–121, 51014 Tartu
  • valdkonna dekanaat
    Faculty phone: 
    737 5341
    Faculty address: 
    Jakobi 2, ruumid 116–121, 51005 Tartu
  • ajaloo ja arheoloogia instituut
    Faculty phone: 
    737 5651
    Faculty address: 
    Jakobi 2, 51005 Tartu
  • eesti ja üldkeeleteaduse instituut
    Faculty phone: 
    737 5221
    Faculty address: 
    Jakobi 2, IV korrus, 51005 Tartu
  • filosoofia ja semiootika instituut
    Faculty phone: 
    737 5314
    Faculty address: 
    Jakobi 2, ruumid 309–352, 51005 Tartu
  • kultuuriteaduste instituut
    Faculty phone: 
    737 5223
    Faculty address: 
    Ülikooli 16, 51003 Tartu
  • maailma keelte ja kultuuride kolledž
    Faculty address: 
    Lossi 3, 51003 Tartu
  • usuteaduskond
    Faculty phone: 
    737 5300
    Faculty address: 
    Ülikooli 18-310, 50090 Tartu
  • Viljandi kultuuriakadeemia
    Faculty phone: 
    435 5232
    Faculty address: 
    Posti 1, 71004 Viljandi
sotsiaalteaduste valdkond
Faculty phone: 
737 5957
Faculty address: 
Lossi 36, 51003 Tartu
  • valdkonna dekanaat
    Faculty phone: 
    737 5900
    Faculty address: 
    Lossi 36, 51003 Tartu
  • haridusteaduste instituut
    Faculty phone: 
    737 6440
    Faculty address: 
    Salme 1a–29, 50103 Tartu
  • Johan Skytte poliitikauuringute instituut
    Faculty phone: 
    737 5582
    Faculty address: 
    Lossi 36–301, 51003 Tartu
  • majandusteaduskond
    Faculty phone: 
    737 6310
    Faculty address: 
    J. Liivi 4, 50409 Tartu
  • psühholoogia instituut
    Faculty phone: 
    737 5902
    Faculty address: 
    Näituse 2, 50409 Tartu
  • õigusteaduskond
    Faculty phone: 
    737 5390
    Faculty address: 
    Näituse 20–324, 50409 Tartu
  • ühiskonnateaduste instituut
    Faculty phone: 
    737 5188
    Faculty address: 
    Lossi 36, 51003 Tartu
  • Narva kolledž
    Faculty phone: 
    740 1900
    Faculty address: 
    Raekoja plats 2, 20307 Narva
  • Pärnu kolledž
    Faculty phone: 
    445 0520
    Faculty address: 
    Ringi 35, 80012 Pärnu
meditsiiniteaduste valdkond
Faculty phone: 
737 5326
Faculty address: 
Ravila 19, 50411 Tartu
  • valdkonna dekanaat
    Faculty phone: 
    737 5326
    Faculty address: 
    Ravila 19, 50411 Tartu
  • bio- ja siirdemeditsiini instituut
    Faculty phone: 
    737 4210
    Faculty address: 
    Biomeedikum, Ravila 19, 50411 Tartu
  • farmaatsia instituut
    Faculty phone: 
    737 5286
    Faculty address: 
    Nooruse 1, 50411 Tartu
  • hambaarstiteaduse instituut
    Faculty phone: 
    731 9856
    Faculty address: 
    Raekoja plats 6, 51003 Tartu
  • kliinilise meditsiini instituut
    Faculty phone: 
    737 5323
    Faculty address: 
    L. Puusepa 8, 50406 Tartu
  • peremeditsiini ja rahvatervishoiu instituut
    Faculty phone: 
    737 4190
    Faculty address: 
    Ravila 19, 50411 Tartu
  • sporditeaduste ja füsioteraapia instituut
    Faculty phone: 
    737 5360
    Faculty address: 
    Jakobi 5–205, 51005 Tartu
loodus- ja täppisteaduste valdkond
Faculty phone: 
737 5820
Faculty address: 
Vanemuise 46–208, 51005 Tartu
  • valdkonna dekanaat
    Faculty phone: 
    737 5820
    Faculty address: 
    Vanemuise 46–208, 51005 Tartu
  • arvutiteaduse instituut
    Faculty phone: 
    737 5445
    Faculty address: 
    J. Liivi 2, 50409 Tartu
  • Eesti mereinstituut
    Faculty phone: 
    671 8902
    Faculty address: 
    Mäealuse 14, 12618 Tallinn
  • füüsika instituut
    Faculty address: 
    W. Ostwaldi 1, 50411 Tartu
  • keemia instituut
    Faculty phone: 
    737 5261
    Faculty address: 
    Ravila 14a, 50411 Tartu
  • matemaatika ja statistika instituut
    Faculty phone: 
    737 5860
    Faculty address: 
    J. Liivi 2, 50409 Tartu
  • molekulaar- ja rakubioloogia instituut
    Faculty phone: 
    737 5011
    Faculty address: 
    Riia 23, 23b–134, 51010 Tartu
  • Tartu observatoorium
    Faculty phone: 
    737 4510
    Faculty address: 
    Observatooriumi 1, Tõravere, 61602 Tartumaa
  • tehnoloogiainstituut
    Faculty phone: 
    737 4800
    Faculty address: 
    Nooruse 1, 50411 Tartu
  • ökoloogia ja maateaduste instituut
    Faculty phone: 
    737 5835
    Faculty address: 
    Vanemuise 46, 51003 Tartu
Asutused
  • raamatukogu
    Faculty phone: 
    737 5702
    Faculty address: 
    W. Struve 1, 50091 Tartu
  • teaduskool
    Faculty phone: 
    737 5581
    Faculty address: 
    Uppsala 10, 51003 Tartu
  • genoomika instituut
    Faculty phone: 
    737 4000
    Faculty address: 
    Riia 23b, 51010 Tartu
  • muuseum
    Faculty phone: 
    737 5674
    Faculty address: 
    Lossi 25, 51003 Tartu
  • loodusmuuseum ja botaanikaaed
    Faculty phone: 
    737 6076
    Faculty address: 
    Vanemuise 46, 51003 Tartu
Tugiüksused
  • ettevõtlus- ja innovatsioonikeskus
    Faculty phone: 
    737 6339
    Faculty address: 
    Lossi 3, III korrus, 51003 Tartu
  • grandikeskus
    Faculty phone: 
    737 6215
    Faculty address: 
    Lossi 3, III korrus, 51003 Tartu
  • hankeosakond
    Faculty phone: 
    737 6632
    Faculty address: 
    Ülikooli 18a, 51005 Tartu
  • infotehnoloogia osakond
    Faculty phone: 
    737 6000, arvutiabi: 737 5500
    Faculty address: 
    Ülikooli 18a, 51005 Tartu
  • kantselei
    Faculty phone: 
    737 5606
    Faculty address: 
    Ülikooli 18a, 51005 Tartu
  • kinnisvaraosakond
    Faculty phone: 
    737 5137
    Faculty address: 
    Ülikooli 18a, 51005 Tartu
  • personaliosakond
    Faculty phone: 
    737 5145
    Faculty address: 
    Ülikooli 18, ruumid 302 ja 304, 50090 Tartu
  • rahandusosakond
    Faculty phone: 
    737 5125
    Faculty address: 
    Jakobi 4, 51005 Tartu
  • rektoraadi büroo
    Faculty phone: 
    737 5600
    Faculty address: 
    Ülikooli 18, 51014 Tartu
  • siseauditi büroo
    Faculty address: 
    Ülikooli 17–103, 51005 Tartu
  • Tallinna esindus
    Faculty phone: 
    737 6600
    Faculty address: 
    Teatri väljak 3, 10143 Tallinn
  • turundus- ja kommunikatsiooniosakond
    Faculty phone: 
    737 5687
    Faculty address: 
    Ülikooli 18, ruumid 102, 104, 209, 210, 50090 Tartu
  • õppeosakond
    Faculty phone: 
    737 5620
    Faculty address: 
    Ülikooli 18, 50090 Tartu
  • üliõpilasesindus
    Faculty phone: 
    737 5400
    Faculty address: 
    Ülikooli 18b, 51005 Tartu
Muud üksused
  • MTÜ Tartu Ülikooli Akadeemiline Spordiklubi
    Faculty phone: 
    737 5371
    Faculty address: 
    Ujula 4, 51008 Tartu
  • MTÜ Tartu Üliõpilasküla
    Faculty phone: 
    740 9959
    Faculty address: 
    Narva mnt 25, 51013 Tartu
  • MTÜ Tartu Üliõpilasmaja
    Faculty phone: 
    730 2400
    Faculty address: 
    Kalevi 24, Tartu
  • OÜ Tartu Ülikooli Kirjastus
    Faculty phone: 
    737 5945
    Faculty address: 
    W. Struve 1, 50091 Tartu
  • SA Tartu Ülikooli Kliinikum
    Faculty phone: 
    731 8111
    Faculty address: 
    L. Puusepa 1a, 50406 Tartu
  • Tartu Ülikooli Sihtasutus
    Faculty phone: 
    737 5852
    Faculty address: 
    Ülikooli 18a–106, Tartu

TÜ üksuste kontaktandmed

humanitaarteaduste ja kunstide valdkond
Faculty phone: 
737 5341
Faculty address: 
Jakobi 2, ruumid 116–121, 51014 Tartu
  • valdkonna dekanaat
    Faculty phone: 
    737 5341
    Faculty address: 
    Jakobi 2, ruumid 116–121, 51005 Tartu
  • ajaloo ja arheoloogia instituut
    Faculty phone: 
    737 5651
    Faculty address: 
    Jakobi 2, 51005 Tartu
  • eesti ja üldkeeleteaduse instituut
    Faculty phone: 
    737 5221
    Faculty address: 
    Jakobi 2, IV korrus, 51005 Tartu
  • filosoofia ja semiootika instituut
    Faculty phone: 
    737 5314
    Faculty address: 
    Jakobi 2, ruumid 309–352, 51005 Tartu
  • kultuuriteaduste instituut
    Faculty phone: 
    737 5223
    Faculty address: 
    Ülikooli 16, 51003 Tartu
  • maailma keelte ja kultuuride kolledž
    Faculty address: 
    Lossi 3, 51003 Tartu
  • usuteaduskond
    Faculty phone: 
    737 5300
    Faculty address: 
    Ülikooli 18-310, 50090 Tartu
  • Viljandi kultuuriakadeemia
    Faculty phone: 
    435 5232
    Faculty address: 
    Posti 1, 71004 Viljandi
sotsiaalteaduste valdkond
Faculty phone: 
737 5957
Faculty address: 
Lossi 36, 51003 Tartu
  • valdkonna dekanaat
    Faculty phone: 
    737 5900
    Faculty address: 
    Lossi 36, 51003 Tartu
  • haridusteaduste instituut
    Faculty phone: 
    737 6440
    Faculty address: 
    Salme 1a–29, 50103 Tartu
  • Johan Skytte poliitikauuringute instituut
    Faculty phone: 
    737 5582
    Faculty address: 
    Lossi 36–301, 51003 Tartu
  • majandusteaduskond
    Faculty phone: 
    737 6310
    Faculty address: 
    J. Liivi 4, 50409 Tartu
  • psühholoogia instituut
    Faculty phone: 
    737 5902
    Faculty address: 
    Näituse 2, 50409 Tartu
  • õigusteaduskond
    Faculty phone: 
    737 5390
    Faculty address: 
    Näituse 20–324, 50409 Tartu
  • ühiskonnateaduste instituut
    Faculty phone: 
    737 5188
    Faculty address: 
    Lossi 36, 51003 Tartu
  • Narva kolledž
    Faculty phone: 
    740 1900
    Faculty address: 
    Raekoja plats 2, 20307 Narva
  • Pärnu kolledž
    Faculty phone: 
    445 0520
    Faculty address: 
    Ringi 35, 80012 Pärnu
meditsiiniteaduste valdkond
Faculty phone: 
737 5326
Faculty address: 
Ravila 19, 50411 Tartu
  • valdkonna dekanaat
    Faculty phone: 
    737 5326
    Faculty address: 
    Ravila 19, 50411 Tartu
  • bio- ja siirdemeditsiini instituut
    Faculty phone: 
    737 4210
    Faculty address: 
    Biomeedikum, Ravila 19, 50411 Tartu
  • farmaatsia instituut
    Faculty phone: 
    737 5286
    Faculty address: 
    Nooruse 1, 50411 Tartu
  • hambaarstiteaduse instituut
    Faculty phone: 
    731 9856
    Faculty address: 
    Raekoja plats 6, 51003 Tartu
  • kliinilise meditsiini instituut
    Faculty phone: 
    737 5323
    Faculty address: 
    L. Puusepa 8, 50406 Tartu
  • peremeditsiini ja rahvatervishoiu instituut
    Faculty phone: 
    737 4190
    Faculty address: 
    Ravila 19, 50411 Tartu
  • sporditeaduste ja füsioteraapia instituut
    Faculty phone: 
    737 5360
    Faculty address: 
    Jakobi 5–205, 51005 Tartu
loodus- ja täppisteaduste valdkond
Faculty phone: 
737 5820
Faculty address: 
Vanemuise 46–208, 51005 Tartu
  • valdkonna dekanaat
    Faculty phone: 
    737 5820
    Faculty address: 
    Vanemuise 46–208, 51005 Tartu
  • arvutiteaduse instituut
    Faculty phone: 
    737 5445
    Faculty address: 
    J. Liivi 2, 50409 Tartu
  • Eesti mereinstituut
    Faculty phone: 
    671 8902
    Faculty address: 
    Mäealuse 14, 12618 Tallinn
  • füüsika instituut
    Faculty address: 
    W. Ostwaldi 1, 50411 Tartu
  • keemia instituut
    Faculty phone: 
    737 5261
    Faculty address: 
    Ravila 14a, 50411 Tartu
  • matemaatika ja statistika instituut
    Faculty phone: 
    737 5860
    Faculty address: 
    J. Liivi 2, 50409 Tartu
  • molekulaar- ja rakubioloogia instituut
    Faculty phone: 
    737 5011
    Faculty address: 
    Riia 23, 23b–134, 51010 Tartu
  • Tartu observatoorium
    Faculty phone: 
    737 4510
    Faculty address: 
    Observatooriumi 1, Tõravere, 61602 Tartumaa
  • tehnoloogiainstituut
    Faculty phone: 
    737 4800
    Faculty address: 
    Nooruse 1, 50411 Tartu
  • ökoloogia ja maateaduste instituut
    Faculty phone: 
    737 5835
    Faculty address: 
    Vanemuise 46, 51003 Tartu
Asutused
  • raamatukogu
    Faculty phone: 
    737 5702
    Faculty address: 
    W. Struve 1, 50091 Tartu
  • teaduskool
    Faculty phone: 
    737 5581
    Faculty address: 
    Uppsala 10, 51003 Tartu
  • genoomika instituut
    Faculty phone: 
    737 4000
    Faculty address: 
    Riia 23b, 51010 Tartu
  • muuseum
    Faculty phone: 
    737 5674
    Faculty address: 
    Lossi 25, 51003 Tartu
  • loodusmuuseum ja botaanikaaed
    Faculty phone: 
    737 6076
    Faculty address: 
    Vanemuise 46, 51003 Tartu
Tugiüksused
  • ettevõtlus- ja innovatsioonikeskus
    Faculty phone: 
    737 6339
    Faculty address: 
    Lossi 3, III korrus, 51003 Tartu
  • grandikeskus
    Faculty phone: 
    737 6215
    Faculty address: 
    Lossi 3, III korrus, 51003 Tartu
  • hankeosakond
    Faculty phone: 
    737 6632
    Faculty address: 
    Ülikooli 18a, 51005 Tartu
  • infotehnoloogia osakond
    Faculty phone: 
    737 6000, arvutiabi: 737 5500
    Faculty address: 
    Ülikooli 18a, 51005 Tartu
  • kantselei
    Faculty phone: 
    737 5606
    Faculty address: 
    Ülikooli 18a, 51005 Tartu
  • kinnisvaraosakond
    Faculty phone: 
    737 5137
    Faculty address: 
    Ülikooli 18a, 51005 Tartu
  • personaliosakond
    Faculty phone: 
    737 5145
    Faculty address: 
    Ülikooli 18, ruumid 302 ja 304, 50090 Tartu
  • rahandusosakond
    Faculty phone: 
    737 5125
    Faculty address: 
    Jakobi 4, 51005 Tartu
  • rektoraadi büroo
    Faculty phone: 
    737 5600
    Faculty address: 
    Ülikooli 18, 51014 Tartu
  • siseauditi büroo
    Faculty address: 
    Ülikooli 17–103, 51005 Tartu
  • Tallinna esindus
    Faculty phone: 
    737 6600
    Faculty address: 
    Teatri väljak 3, 10143 Tallinn
  • turundus- ja kommunikatsiooniosakond
    Faculty phone: 
    737 5687
    Faculty address: 
    Ülikooli 18, ruumid 102, 104, 209, 210, 50090 Tartu
  • õppeosakond
    Faculty phone: 
    737 5620
    Faculty address: 
    Ülikooli 18, 50090 Tartu
  • üliõpilasesindus
    Faculty phone: 
    737 5400
    Faculty address: 
    Ülikooli 18b, 51005 Tartu
Muud üksused
  • MTÜ Tartu Ülikooli Akadeemiline Spordiklubi
    Faculty phone: 
    737 5371
    Faculty address: 
    Ujula 4, 51008 Tartu
  • MTÜ Tartu Üliõpilasküla
    Faculty phone: 
    740 9959
    Faculty address: 
    Narva mnt 25, 51013 Tartu
  • MTÜ Tartu Üliõpilasmaja
    Faculty phone: 
    730 2400
    Faculty address: 
    Kalevi 24, Tartu
  • OÜ Tartu Ülikooli Kirjastus
    Faculty phone: 
    737 5945
    Faculty address: 
    W. Struve 1, 50091 Tartu
  • SA Tartu Ülikooli Kliinikum
    Faculty phone: 
    731 8111
    Faculty address: 
    L. Puusepa 1a, 50406 Tartu
  • Tartu Ülikooli Sihtasutus
    Faculty phone: 
    737 5852
    Faculty address: 
    Ülikooli 18a–106, Tartu

Sangeri sekveneerimine ja genotüpiseerimine

NB! Suveperioodil (juuni-august) tuleb kiirtellimuse proovid tuua kohale hiljemalt kl 9.00 
Eesti Biokeskuse tuumiklabor on alates 2006. aastast pakkunud erinevaid sekveneerimise ning genotüpiseerimise teenuseid. Meile teadaolevalt oleme Eestis ainus Sanger-tüüpi sekveneerimise teenusepakkuja. Teenused jaotuvad kaheks - DNA sekveneerimise täisteenuseks ja kapillaarelektroforeesiks. Esimese puhul viime läbi sekveneerimisreaktsiooni ja sellele järgneva uurimismaterjali ettevalmistamise, teise puhul lähevad tellija poolt ette valmistatud materjalid otse analüsaatorisse. 
Analüüse viime läbi Applied Biosystemsi kapillaarelektroforeesimasinatel.  
Kontakt:
kapillaar [ät] ebc.ee
+372 737 4020 
Postiaadress:
TÜ EBK tuumiklabor
Riia mnt 23b-302
51010 Tartu 
 
 

DNA sekveneerimise täisteenus

DNA sekveneerimise täisteenuse puhul saadab tellija meile oma uuritava PCR-i produkti või plasmiidi ning sekveneerimispraimerid (või valib praimeri meie poolt pakutavate universaalpraimerite hulgast). Meetodi põhimõttega saate tutvuda siin.  
Sekveneerimist viime läbi Applied Biosystems 3130xl Genetic Analyzer'il ja kahel Applied Biosystems 3730xl DNA Analyzer masinal. 
DNA sekveneerimise täisteenuse tellimiseks on vaja: 
  • Saata matriits-DNA - plasmiidi puhul 300-500 ng reaktsiooni kohta, PCR-i produkti puhul 30-50 ng reaktsiooni kohta. Igas reaktsioonisegus saame kasutada kuni 5,7 µL DNA-d 
  • Saata praimerid - 10 µM (ehk 10 pmol/µL) kontsentratsiooniga praimerit kulub ühe reaktsiooni peale 0,2 µL (kuid palume saata mitte vähem kui 2-3 µL) 
  • Täita tellimisleht, saata aadressile kapillaar [ät] ebc.ee, samuti trükkida välja ning proovidega kaasa pakkida
Pakk DNA, praimerite ning tellimislehega saata aadressile 
TÜ EBK tuumiklabor
Riia mnt 23b-302
51010 Tartu 
Kui toote saadetise ise ära, siis ootame neid Riia maantee poolse valvuri juures olevasse külmkappi (kapp märgistatud sildiga "Sekveneerimine"). 
Meilt saab tellida reaktsioone järgmiste universaalpraimeritega:
Praimer Järjestus ap
EBV-RP GTGGTTTGTCCAAACTCATC 20
ITS4 TCCTCCGCTTATTGATATGC 20
ITS5 GGAAGTAAAAGTCGTAACAAGG 22
M13F GTAAAACGACGGCCAGT 17
M13F-pUC(-40)  GTTTTCCCAGTCACGAC 17
M13R GCGGATAACAATTTCACACAGG 22
M13R-pUC(-40) CAGGAAACAGCTATGAC 17
pJET1.2F CGACTCACTATAGGGAGAGCGGC 23
pJET1.2R AAGAACATCGATTTTCCATGGCAG 24
SP6 ATTTAGGTGACACTATAG 18
SV40-pA-rev CCTCTACAAATGTGGTATGG 20
SV40-promoter GCCCCTAACTCCGCCCATCC 20
T3 ATTAACCCTCACTAAAG 17
T7 AATACGACTCACTATAG 17
T7promoter TAATACGACTCACTATAGGG 20
T7terminator GCTAGTTATTGCTCAGCGG 19
Lisateenusena pakume PCR-i produktide ensümaatilist puhastamist, mida viime läbi Thermo Scientific FastAP Thermosensitive Alkaline Phosphatase'i ja Exonuclease I-ga. 
Ühtlasi on võimalik tellida kiirteenust, mille puhul garanteeritakse Teile tulemuste kättesaamine materjalide meile jõudmise ajast arvestades 24 h jooksul. Kui soovite kiirtellimuse vastuseid sama tööpäeva jooksul, siis peavad proovid olema meieni jõudnud hiljemalt kell 10.00. NB! Suveperioodil (juuni-august) tuleb kiirtellimuse proovid tuua kohale hiljemalt kell 9.00. Kiirteenuse tellimiseks tehke sellekohane märge saatelehe lahtrisse "Märkused". 
Samuti pakume keerulise matriitsi sekveneerimist, mida soovitame kasutada nukleotiidseid kordusi sisaldava, GC-rikka või sekundaarstruktuure moodustava materjali puhul. Keerulise sekveneerimise tellimiseks tehke sellekohane märge saatelehe lahtrisse "Märkused". 
 

Kapillaarelektroforees

Kapillaarelektroforeesi viime läbi Applied Biosystems 3130xl Genetic Analyzer masinaga. 
1. Valmis reaktsioonide sekveneerimine 
Sekveneerime ka teie poolt valmistatud reaktsiooniprodukte. Produktid peavad olema valmistatud kasutades BigDye® Terminator v3.1 (erandjuhul ja sellekohase märkega ka BigDye® Terminator v1.1) ensüümimiksi, puhastatud üleliigsetest praimeritest ja nukleotiididest ning suspendeeritud 10 μL formamiidis (70% formamiid või Applied Biosystemsi Hi-DiTM formamiid). Tellimuse esitamiseks pole saatelehte vaja täita, saatke proovide nimekiri kapillaar [ät] ebc.ee aadressile *.txt failina, lisades juurde ka teenuse eest tasuja. 
2. Fragmentanalüüs 
Peale sekveneerimise viime läbi ka mikrosatelliitide analüüsi, MLPA analüüsi, genotüpeerimist (Applied Biosystems SNaPshot Multiplex System) jm. Tellimuse esitamiseks pole saatelehte vaja täita, saatke proovide nimekiri kapillaar [ät] ebc.ee aadressile *.txt failina, lisades juurde ka teenuse eest tasuja ning kasutatud märgiste kombinatsioon. Teenust saab tellida ka nii, et kasutate meie poolt pakutavat ROX 500, LIZ 500 või LIZ 1200 pikkusmarkerit. 
Üldjuhul valmistab klient uuritava materjali ette kuni analüüsi läbiviimiseni, meie teostame vaid proovide denatureerimist vahetult enne analüüsi. 
Võimalikud värvikombinatsioonid: 
Filter Dye set Sinine Roheline Kollane Punane Pikkusmarker
D DS-30 6FAM HEX NED   ROX
G5 DS-33 6FAM VIC NED PET LIZ
E5 DS-02 dR110 dR6G dTAMRA dROX LIZ
4Dye Custom 6FAM HEX TAMRA   ROX
5Dye Custom FL JOE TMR-ET CXR-ET WEN
F Promega FL JOE TMR   CXR
NB! Pikkusmarker lisatakse igasse proovi. Fragmentanalüüsi proovide resuspendeerimisel tuleb kvaliteetse tulemuse saamiseks kasutada Applied Biosystemsi Hi-DiTM formamiidi. Minimaalne tellimuse suurus on 16 proovi. 
Fragmentanalüüsi meetodite laia valiku tõttu palume enne esimese tellimuse tegemist meiega aadressil kapillaar [ät] ebc.ee ühendust võtta, et plaanid läbi rääkida.